Examples of 'mouse chromosome' in a sentence
Meaning of "mouse chromosome"
mouse chromosome: This phrase pertains to the structures within cells of mice that carry genetic information and determine various traits or characteristics
How to use "mouse chromosome" in a sentence
Basic
Advanced
mouse chromosome
We talked yesterday about how the mouse chromosome is different than the human.
The mouse genetic map includes a homologous region located on mouse chromosome 5.
LTn was placed on mouse chromosome one by interspecific backcross analysis.
LTn maps in the distal region of mouse chromosome one.
Only one mouse chromosome hybridizes with the AIF cDNA in situ Fig.
Analysis of the ckr mouse genome indicates genetic rearrangements on mouse chromosome 16.
CTACK was placed on mouse chromosome 4 by interspecific backcross analysis.
MCTACK maps in the proximal region of mouse chromosome 4.
Pieces of mouse chromosome 13 were inserted into mice that were susceptible to Legionella infection.
The Wlds mutation is an autosomal-dominant mutation occurring in the mouse chromosome 4.
It is syntenic to mouse chromosome 13, where the mouse vasa gene, is located.
Figure 21 shows a possible insertion site for the human DNA in a mouse chromosome.
It is aligned with a region in mouse chromosome 2 that shares 72 % sequence identity.
The 1p36 region possesses a syngeneic homology with the distal segment of the mouse chromosome 4.
Genes encoding the antigen have been mapped to mouse chromosome 1A and human chromosome 2q31.
See also
Figure 6 is a diagrammatic representation showing that Bcl-w maps in the central region of mouse chromosome 14.
Thus, the chromosomes are the same type ( eg, both mouse chromosome 6 or rat chromosome 4 ).
Interestingly, the Dom mutation has been mapped to the middle-terminal region of mouse chromosome 15.
This gene spans about 8 kilobases and maps to mouse chromosome 19.
The natural target DNA sequence caaaactatgtagagggttttg ( SEQ ID NO, 75 ) was identified in mouse chromosome 17.
The gene for MCP-5 is found in a cluster of CC chemokines on mouse chromosome 11.
You'll also be interested in:
Examples of using Mouse
Show more
My mouse does not work on a mirror or glass surface
To clean your mouse ball and cage
A mouse and an elephant walk over a bridge
Examples of using Chromosome
Show more
We suspect this extra chromosome may be synthetic
Chromosome of interest must be specified on request form
We suspect this extra chromosome maybe is synthetic