Examples of 'targeting domain' in a sentence

Meaning of "targeting domain"

targeting domain - This phrase is commonly used in the context of marketing or advertising to refer to focusing on a specific area or audience for promotional purposes

How to use "targeting domain" in a sentence

Basic
Advanced
targeting domain
Typically the targeting domain has full complementarity with the target sequence.
Wherein the drug delivery molecule further comprises a targeting domain and a positively charged domain.
A targeting domain such as a single-chain antibody or an antibody fragment domain.
Constructs lacking a membrane targeting domain did not yield detectable HA.
One group of re-targeted endopeptidase comprises molecules having an opioid targeting domain.
In some embodiments, the targeting domain does not have a biological activity.
The polypeptide of claim 8, wherein the polypeptide further comprises a targeting domain of heregulin.
In another aspect, the endosomal targeting domain comprises a transmembrane sequence.
The Fc polypeptide preferably is fused to the C-terminus of a catalytic or targeting domain.
Preferably, binding of the targeting domain to the target molecule does not have a biological activity.
The Clostridial toxin substrates disclosed in the present specification include, in part, a membrane targeting domain.
In the targeting lipid, the targeting domain can be directly attached to the hydrophobic domain.
For example, in certain embodiments of the disclosure, the targeting domain is,.
In a further aspect, the targeting domain comprises an EDE domain.
In other embodiments, the half-life modulator is joined at the C-terminus of the targeting domain.

See also

The mitochondrial targeting domain directs FASTKD3 to be imported into the mitochondria.
For example, in certain embodiments, the targeting domain is, GAAUCCUGAAAGCUACU.
The hybrid protein may comprise a modified PE40 domain bonded to a TGF-alpha targeting domain.
FIGURE 1B illustrates a non-limiting schematic of a targeting domain of a chimeric antigen receptor of the present invention.
The targeting domain can be located at the N - or C-terminus of the MPP, or both.
A CAR according to claim 7 wherein the antigen-specific targeting domain comprises an antibody or fragment thereof.
In other embodiments, the targeting domain is synaptotagmin I, fragment thereof, or variant thereof.
In one embodiment, a CD38BP is conjugated to a tumor targeting domain peptide or molecule.
In some embodiments, the targeting domain has sequence recited in SEQ ID.
In one embodiment, a CD38 antibody is conjugated to a tumor targeting domain peptide or molecule.
In some embodiments, the targeting domain is selected from those in Table 10.
The therapeutic reagent is an immunoconjugate composed of a targeting domain and an effector domain ( Figure 1 ).
In an embodiment, the targeting domain is 5 to 50 nucleotides in length.
A CAR according to claim 12 wherein the antigen-specific targeting domain is a single chain variable fragment.
In some embodiments, the targeting domain is selected from those in Tables 7A-7D.
For example, in certain embodiments, the targeting domain is, GCUACCGGUUACCUGAA ;.
In an embodiment, the targeting domain comprises 19 nucleotides.
In a preferred embodiment, the antigen-specific targeting domain is, or is derived from, an antibody.
For example, in certain embodiments, the targeting domain is, GCUAAAUCAUGCAAGUGACCUAAG ;.
For example, in certain embodiments, the targeting domain is, GCACCUGGCCCCAGUUGUAAUU.
For example, in certain embodiments, the targeting domain is, GAGAUACUCACAAUUACAAC ; or.
Analog according to claim 1 or 2, wherein the targeting domain is the cell adhesion peptide RGD.
For example, in certain embodiments, the targeting domain is, GAAAGAUGAAAAAUACUCUU ;.
For example, in certain embodiments, the targeting domain is, GAGUUCAAGCUAAUACAUGA ;.
For example, in certain embodiments, the targeting domain is, GGCAAAAGCAGCAGAAAGCA ;.
We will use sequences for the CAR targeting domain derived from SEQ ID NOs, 1-6.

You'll also be interested in:

Examples of using Domain
All domain names must be in upper case
In the educational domain projects under way
Cross domain business and governmental projects
Show more
Examples of using Targeting
It seems someone is targeting rich guys in seattle
The targeting of humanitarian personnel in a conflict is unacceptable
They will not be targeting anyone else
Show more

Search by letter in the English dictionary