Examples of 'vector sequences' in a sentence
Meaning of "vector sequences"
Vector sequences: Refers to a series of vectors arranged in a specific order
How to use "vector sequences" in a sentence
Basic
Advanced
vector sequences
The plasmid vector sequences are not shown.
The underlined nonspecific residues are encoded by vector sequences.
The pKUN vector sequences are represented by thick lines.
This was not due to polyadenylation or to differences in vector sequences.
Vector sequences are shown by an open line.
Helices indicate vector sequences.
Vector sequences flanking the gD coding sequence are shown.
On either side of each gene cassette a few bp of vector sequences are present.
Vector sequences are represented by hatched boxes.
The transgene constructs are isolated from vector sequences by digestion with NotI.
Vector sequences were confirmed by sequencing.
Double recombination events lead to the excision of the exogenous vector sequences.
Vector sequences are in italics.
In one embodiment the transcriptionally active polynucleotide does not comprise backbone vector sequences.
These vector sequences are the sequences required for surface expression of randomized peptides.
See also
Several restriction sites for polylinker enzymes within the vector sequences were eliminated by mutageneses.
The vector sequences donated from each independent vector are necessary for production of viable phage.
These results suggest that complete vector sequences are frequently integrated into the plant genome.
The underlined amino acids at the amino and carboxy termini are derived from vector sequences.
Boxes on either end represent vector sequences and the solid center line denotes the insert.
The genes were amplified by PCR reactions with end matching to the vector sequences.
Integration of YAC vector sequences was examined using probes specific for the vector arms.
DHFR sequences also can provide a marker for selection and amplification of vector sequences.
PCR with primers homologous to expression vector sequences or sequences encoding KCNQ protein.
These changes enable more flexibility to liberate the left ITR from the plasmid vector sequences.
Preferably, the vector sequences provide delivery of the nucleic acid molecules to the appropriate cells.
The probe consisted of the full length SMRV genome isolated from the plasmid vector sequences.
This expression cassette was ligated to vector sequences generating the construct shown in Figure 6.
Representative expression vectors include both plasmid and / or viral vector sequences.
It also contains vector sequences for replication and selection in E. coli and the S.
An isolated recombinant host cell comprising the vector sequences of claim 2.
Wild-type viral and pUC8 vector sequences are designated by slashed and open regions, respectively.
When selection pressure is released, the marker gene is excised together with vector sequences.
NO 41 vectors were obtained ; both vector sequences were confirmed by sequenciation with pAd-sense TGTTTTTCTCAGGTGTTTTCCG ; SEQ.
The open boxes represent open reading frames, and the solid boxes represent cloning vector sequences.
The HPV 52 L1 gene was released from the vector sequences with Bgl II restriction endonuclease digestions.
CHO cells, which allows selection for amplified vector sequences.
Appropriate yeast vector sequences were provide by the " disintegration " plasmid pSAC35.
An isolated recombinant host cell comprising the vector sequences of E3.
The pKUN vector sequences are represented by thick lines . Fig . 4.
Prior to vaccination, the cassette may be isolated from vector sequences by cleavage, amplification, etc.
Preferably, less than about 50 base pairs of the minimal transgene expression cassette are vector sequences.
Vector sequences and insert sequences are set forth in SEQ ID NOs, 5-8.
The RX1 system yielded a fusión protein containing 20 amino acids encoded by trpE and vector sequences.
The N - and C - terminal vector sequences are derived from the expression vector pET28.
APCR1 and APCR4 hybridised to the flanking pUC19 vector sequences.
A subclone of XTY26 has been generated which contains both Do33 and vector sequences.
You'll also be interested in:
Examples of using Vector
Show more
Orbit approach vector alpha niner juliet
A vector is an organism that can transport a pathogen
You have got wind vector fluctuations
Examples of using Sequences
Show more
A few thin rhyolite sequences are also observed
The sequences that make you possible
I shot the desert sequences without permits
