Examples of 'immunostimulatory nucleic acid' in a sentence
Meaning of "immunostimulatory nucleic acid"
immunostimulatory nucleic acid - This term refers to a type of molecule that has the ability to enhance the immune response in the body by activating specific immune cells, such as T cells or B cells, to recognize and target pathogens or abnormal cells
How to use "immunostimulatory nucleic acid" in a sentence
Basic
Advanced
immunostimulatory nucleic acid
In some aspects the immunostimulatory nucleic acid is modified.
Immunostimulatory nucleic acid molecules have been implicated in the pathogenesis of arthritis.
In yet other embodiments the immunostimulatory nucleic acid has a chimeric backbone.
The immunostimulatory nucleic acid molecules described herein have a variety of lengths.
Also according to preferred embodiments the immunostimulatory nucleic acid has a modified backbone.
The immunostimulatory nucleic acid useful in the kit is as described herein.
In some embodiments, the immunostimulatory nucleic acid is modified.
The immunostimulatory nucleic acid molecules may have a chimeric backbone.
In one embodiment, the lipid particle comprises an immunostimulatory nucleic acid or oligonucleotide.
Preferably the immunostimulatory nucleic acid is present in the composition in an effective amount.
An oligonucleotide as claimed in claim 1, wherein the immunostimulatory nucleic acid molecule,.
In some embodiments the immunostimulatory nucleic acid is administered by a mucosal route.
Based on this finding, the invention features, in one aspect, novel immunostimulatory nucleic acid compositions.
In some embodiments the immunostimulatory nucleic acid is an isolated nucleic acid.
In an embodiment the oligonucleotide comprising 5 ' Y1N1ZN2Y2 3 ' is administered separately from the immunostimulatory nucleic acid.
See also
In some embodiments the immunostimulatory nucleic acid is a synthetic nucleic acid.
The immunostimulatory nucleic acid molecules of the instant invention have chimeric backbone.
Figure 26 shows ionic strength increases immunostimulatory nucleic acid packaging into QB VIPs.
The immunostimulatory nucleic acid and other therapeutic agent may be administered simultaneously or sequentially.
In a particular embodiment of the invention, the immunostimulatory nucleic acid sequence is a single-stranded RNA.
The immunostimulatory nucleic acid molecules of the present invention may have a chimeric backbone.
In other embodiments the Py-rich immunostimulatory nucleic acid is a C-rich nucleic acid.
The immunostimulatory nucleic acid molecules of the instant invention may include chimeric backbones.
The method described in paragraph 1, wherein the CpG immunostimulatory nucleic acid comprises a semi-soft backbone.
Z is an immunostimulatory nucleic acid motif but does not include a CG.
In other embodiments, the immunostimulatory nucleic acid may be T-rich.
Immunostimulatory nucleic acid molecules comprising GTCGTT motifs.
In one embodiment, the immunostimulatory nucleic acid is a TG nucleic acid.
The CpG immunostimulatory nucleic acid is a C class immunostimulatory nucleic acid.
In important embodiments, the CpG immunostimulatory nucleic acid is a C class immunostimulatory nucleic acid.
An immunostimulatory nucleic acid molecule can be double-stranded or single-stranded.
In other embodiments the immunostimulatory nucleic acid is 5 ' DCGHP 3 '.
An immunostimulatory nucleic acid as claimed in claim 9 wherein said antigen is a peptide antigen.
In some embodiments the immunostimulatory nucleic acid is administered by a parenteral route.
An immunostimulatory nucleic acid as claimed in claim 3 wherein,.
In other embodiments the immunostimulatory nucleic acid has a completely phosphodiester backbone.
An immunostimulatory nucleic acid as claimed in claim 1, comprising the sequence,.
In some embodiments the immunostimulatory nucleic acid has a completely nuclease-resistant backbone.
An immunostimulatory nucleic acid as claimed in claim 1, wherein the immunostimulatory nucleic acid,.
In some embodiments the immunostimulatory nucleic acid is administered in a sustained-release vehicle.
The immunostimulatory nucleic acid molecule is a B-Class or C-Class immunostimulatory nucleic acid molecule ;.
In some embodiments, a CpG immunostimulatory nucleic acid is used in the methods of the invention.
Z is an immunostimulatory nucleic acid motif, preferably selected from the immunostimulatory oligonucleotide recited herein.
In one embodiment the immunostimulatory nucleic acid is a T-rich nucleic acid.
The immunostimulatory nucleic acid molecule is not an antisense oligonucleotide, triple-helix-forming oligonucleotide, or ribozyme.
In some embodiments, the CpG immunostimulatory nucleic acid is a C class immunostimulatory nucleic acid.
The immunostimulatory nucleic acid may have a poly-T sequence at the 5 ' end or at the 3 ' end.
In one preferred embodiment, the immunostimulatory nucleic acid has a poly T motif and a phosphorothioate backbone.
An immunostimulatory nucleic acid comprising the sequence TCGTCGTTTTACGGCGCCGTGCCG ( SEQ ID NO, 13 ).
In other embodiments the immunostimulatory nucleic acid has a base sequence comprising 5 ' DCGHP 3 '.
You'll also be interested in:
Examples of using Immunostimulatory
Show more
This agent may have immunostimulatory effects
Immunostimulatory oligonucleotides can be free of CpG dinucleotides
A muramyl dipeptide derivative is the immunostimulatory component
Examples of using Nucleic
Show more
Both lipids and nucleic acids are degraded
Nucleic acid sequencers for scientific purposes
A virus is a string of nucleic acid with attitude
Examples of using Acid
Show more
Put citric acid in the inner container
He later admitted that he did it while tripping on acid
I was so busy pissing acid on that little shit
