Examples of 'nucleobase sequence' in a sentence
Meaning of "nucleobase sequence"
nucleobase sequence refers to the specific order or arrangement of nucleobases in a strand of DNA or RNA
How to use "nucleobase sequence" in a sentence
Basic
Advanced
nucleobase sequence
Preferably the probing nucleobase sequence hybridizes to the entire target sequence.
In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.
The probing nucleobase sequence is complementary or substantially complementary to a target sequence of interest.
Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
The probing nucleobase sequence is the same for all probes listed in the table.
The term “ target sequence ” refers to the nucleobase sequence sought to be determined.
The probing nucleobase sequence of a Linear Beacon is the sequence recognition portion of the construct.
In certain embodiments, an antisense oligonucleotide has a nucleobase sequence comprising the nucleobases of such sequence.
The target nucleic acid contains two or more parts, each part containing a nucleobase sequence.
Since the probing nucleobase sequence of the probe is Seq.
In certain instances, the nucleic acid molecules encoding a connexin have a nucleobase sequence selected from SEQ.
Preferably, the probing nucleobase sequence is perfectly complementary to the target sequence.
Antisense compounds described by Isis Number ( Isis No ) indicate a combination of nucleobase sequence and motif.
Typically, the probing nucleobase sequence of the immobilized probe is judiciously chosen to interrogate a sample.
The oligonucleotide of claim 1, wherein the nucleobase sequence of the oligonucleotide,.
See also
Preferably, the nucleobase sequence is essentially complementary to the sequence shown in SEQ ID NO, 1.
As used herein, a " genotype " is the nucleobase sequence of a nucleic acid.
In certain embodiments, the nucleobase sequence of a modified oligonucleotide has full-length complementary to a miRNA.
In one embodiment, the oligonucleotide consists of the nucleobase sequence of SEQ ID NO, 6.
Additionally, a shorter probing nucleobase sequence can be generated by truncation of the above identified sequence.
Even more preferably, the antisense compound has a nucleobase sequence of SEQ ID NO, 90.
In another embodiment, the nucleobase sequence of the oligomer consists of the contiguous nucleobase sequence.
In certain other embodiments, an antisense compound comprises a nucleobase sequence selected from SEQ ID NO, 1-3.
The two oligomers contain identical nucleobase sequence but differ from another at the Y-backbone.
A polymer as claimed in Claim 1, wherein the probing nucleobase sequence is 5-30 subunits in length.
Preferably, the probing nucleobase sequence will be 8 to 18 subunits in length.
In one embodiment, the oligonucleotide comprises the nucleobase sequence " GCCTCAGTCTGCTTCGCACC " ( SEQ ID NO, 2 ).
Probes having this or a similar nucleobase sequence are suitable for detecting M. kansasii.
The method of Paragraph 1, wherein said oligonucleotide comprises the nucleobase sequence " GCCTCAGTCTGCTTCGCACC " ( SEQ ID NO, 2 ).
Preferably, the probing nucleobase sequence is 5 to 30 sub units in length.
Connexins that may be targeted include connexins having a nucleobase sequence selected from SEQ ID NO, 12-31.
In one embodiment, the oligomer or contiguous nucleobase sequence has a length of between 10 - 18 nucleobases.
You'll also be interested in:
Examples of using Sequence
Show more
Convenient sequence programming with graphic symbols
This simultaneously establishes an efficient work sequence
Sample of sequence of targets for newspaper microfilming
Examples of using Nucleobase
Show more
Adenine is a nucleobase synthesized by the human body
One group exploited the nucleobase adenine
The nucleobase may be a pyrimidine or derivative thereof