Examples of 'using primer' in a sentence
Meaning of "using primer"
using primer: This phrase refers to the use of a basic introductory text or guide that provides fundamental knowledge or instructions on a particular subject. It is often used in educational contexts to help learners grasp essential concepts before advancing to more complex material
How to use "using primer" in a sentence
Basic
Advanced
using primer
Approaches using primer extension and detection by fluorescence have been shown.
Figure 7 shows the results of an assay for crossreactivity using primer combination 2.
PCRs were performed using primer pairs derived from each of two sets of primers.
In the resulting plasmid the insert has been fully sequenced using primer 982.
PCRs were performed using primer pairs derived from one Taql - and one Nlalll-AFLP primer.
Using plMC06 as a template, the terminator region was reamplified by PCR using primer.
Primer and probes were designed using Primer Express software ( Applied Biosystems ).
Using primer extension experiments, the 5 ' end of transcription was identified.
Thermal SDA reactions were performed using primer set F using the best assay conditions of Example 11.
The transcription initiation site of manP - promotor was determined by using primer s5006.
For example, the primer sequences can be designed using Primer Expression ( Perkin-Elmer Applied Biosystems ).
The sequence of 450 bp flanking one end of the transposon was determined using primer P7.
Hhhmm… I'm guilty of several, but not using primer is probably the main one.
Nucleic acid PCR fragment generated from genomic DNA of Mutant 8063, amplified using primer set no.
The primers and the probe are designed by using Primer Expression ( Perkin-Elmer Applied Biosystems ).
See also
The -005 VH region was sequenced directly on the PCR product by using primer HCseq5.
The diluted samples were then tested using primer sets 1-30 as described in Example 3.
Individual clones were isolated, and plasmids purified were sequenced using primer beta-1 ( vida supra ).
Primers and probes were designed using Primer Express software ( v2.1, PE Applied Biosystems ).
Individual clones were isolated, and plasmids purified were sequenced using primer beta-1 ( vide supra ).
Oligonucleotide primers were selected using Primer Express 2.0 ( Applied Biosystems ).
Figure 5C shows amplification using primer set 12.
This was done using a linker obtained using primer MUT11 and MUT12.
This has been done by introducing a silent point mutation using Primer 3, AGAAATCGGGTATCCTTTCAG ( SEQ ID No. 1 ).
You'll also be interested in:
Examples of using Primer
Show more
The primer includes the following modules
It was mostly gray primer and fender fill
A primer is not necessary for small repairs
Examples of using Using
Show more
Mash kidney beans using a potato masher
Log in using the default administrative account
Proportion of households using a clean water source
